Date: Sun, 1 Dec 2002 11:04:18 +0100 From: Johan Meskens CS2 jmcs2 Subject: | || " || - - - : |_| " || |||||| |||||| |||||| |||| ||||||| | ' ~" || | |- -||- - -||- -| |- - --- - --- - - - --- -| " | | || " || - - - : |_| " || |||||| |||||| |||||| |||| ||||||| | ' ~" || | | || || || || || || | > | > | | ­ | -Ý | ) | | | - | - | , | | | | | | | | | ------ | £ | | | _ | | | | -- { , , , , ^ +> ¬, ._ , >, | -------- -# "# - > > , , , ' , , , , } | ? ,, >, , >, , #, > | --------- ö > Ù+ , , , , , |_ , >, | ------------- ¾ \\ .>| , , . ! !, >,, , , , | -------------- & ;& Ýú > , , , <-----, - , >, ), | " . [ ] | " ' ./ , | " ' .. . . . . . .. . .. | " ' .. . . . . . .. . .. | " ' .. . . . . . .. . .. | " ' .. . . . . . .. . .. | " ", [ :: | => ' × . ] | " .. ... .... ..... ...... . . . .. | ' " | "* _, " |---------------------------------------------------------------------[ |---------------------------------------------------------------------[ |---------------------------------------------------------------------[ |---------------------------------------------------------------------[ |---------------------------------------------------------------------[ |---------------------------------------------------------------------[ | " _ | " _ | " _ . " " " " = | " " " " " " .. | | | <------> | <------> | <------> | <------> | <------> | <------> | - < > - | - < > - . From: pascale gustin Subject: Load------------------------------ing Date: Sun, 01 Dec 2002 22:13:39 +0100 ----------: --------: ------- Finished loading ----------: --------: ------- Load-----------R------------------i--g-N( )O-re Load-----------e------------------ing Load-----------a------------------ing Load-----------d------------------ing ----------: --------: ------- j'ai du désir parfois et parfois du d.sir pas de dés ir-Q d'autres fois pas ded (Projects)_S 39 _t u tout du d.sir et pas de d ésir c'est ch-IMI-que je crois j'ai l'i-IMI mPres~~ siOn que tout ça c'est chimique que c est dans le cOR(gan)Ps ps et c'est chimique ça sui=NTE dans tout le cOR[e]ps Load-----------i------------------ing Load-----------n------------------ing Load-----------g------------------ing Load------------------------------ing ----------: --------: ------- Load------------------------------ing ----------: --------: ------- (computer-generated)_S 61 _t (writing.)_S 1207 6876 _m (Projects)_S 39 _t (have)_S 38 _t (ranged)_S 39 _t (from)_S 39 _t (programs)_S 38 _t (designed)_S 39 _t ----------: --------: ------- Loading dired Reading directory Reading directory Reading directory Load------------------------------ignOR.anc[hor]e Note: file is write protected Reading directory ----------: --------: ------- From: Alan Sondheim Subject: brush-shaft messages Date: Wed, 4 Dec 2002 00:49:37 -0500 (EST) brush-shaft messages SINEW OF BOW AND ARM AND BRUSH THE BODY MEMORIZES THE TS'AU-SHU CONTINUATION MUSCLE MEMORY TURNS THE LINE MUSCLE MEMORY RELEASES STONE DRUM STYLE CLOUDS THE ACCUMULATION OF THE QUESTION MARK =] ={ =$ > >< >> >| >_ >- >, >: >? >/ >. >" >( >[ >@ >\ | |^ |~ |< |= ||wn personalized watc lisp phoenix.hlp tiny.worldt |_ |- |, |: |! |/ |. |[ |] |$ |* |\ |+ _ _` _^ _~ _< _= _| __ _- _, _; _:icely, in ways. Only masochistic egotist egotist self-destructing fancies _! _/ _. _' _" _( _[ _* _& -^ -< -= -> -| -_ -- -, -; -: -! -. -" -( -) -[+ 'benefit' theft. from When murder WOW! theft. attack When another, the l -] -@ -* -\ -& -# , ,` ,^ ,= ,_ ,, ,; ,. ," ,( ,[ ,# ; ;> ;| ;- ;; ;" ;(nefit' another, from first. self-destruction Sarcasm of =solete software ;) ;[ ;$ ;* : :^ :< := :> :_ :- :: :! :/ :. :' :" :( :) :[ :@ :$ :* :# !destruction + nevrous attack life-force on, MOTHER addressing this probl !~ !< != !, !! !" !$ !* !\ !+ ? ?~ ?= ?- ?: ?! ?? ?" ?) ?[ ?] ?\ / /^ / /| /_ /- /, /; /: /! /? // /. /" /( /[ /@ /* /\ /# /+ . .< .= . the As lovely lovelR '( ') '[ '{ '$ '\ '+ " "` "< "= "> "| "_ "- ", "; ": "! "? "/ ". "' "" "(===== 7 D MISERABLE-ME I'm irresponsible pretending murderous to id ") "[ "] "} "@ "$ "* "\ "& "# "% "+ ( (` (< (= (_ (- (! (? (/ (. (' ("of my favo an be to 'artist' its excuse murderous its idiot impotence abuse atte (( () ([ (] (@ ($ (* (# (+ ) )= ), ); ): )? )/ ). )" )( )) )[ [ [` [^ [ [_ [- [, [; [: [! [? [. [' [" [( [) [[ [] [$ [* [& [# ] ]` ]^ ]- ], ];or an e + 'benefit' theft. from When murder WOW! theft. attack When anoth ]: ]/ ]. ]" ][ ]] ]} ]@ { {- {: {. {' {" {( {[ {{ {} {$ } }- }: }? }. }'8% les/= /> /| /_ /- /, /; /: /! /? // /. /" /( /[ /@ /* /\ /# /+ . .< .= ._ .- What if I told you thator deletion]2-406-256 smiles and milesrondheim ., .; .: .! .? ./ .. ." .) .$ .* .# 7 8 ' '^ '< '| '_ '; ': '! '/ '. '' '"2 lines Text (charset: ISO-8859-1)Preserving the Rhizome Ar Co '( ') '[ '{ '$ '\ '+ " "` "< "= "> "| "_ "- ", "; ": "! "? "/ ". "' "" "( Dec 3 lycoslotto (4690) --------------------------------- ") "[ "] "} "@ "$ "* "\ "& "# "% "+ + ; ( (` (< (= (_ (- (! (? (/ (. (' (" the "iso-8859-1" character set. ]n (7451) RHIZOME_RAW: logic vs flux (( () ([ (] (@ ($ (* (# (+ ) )= ), ); ): )? )/ ). )" )( )) )[ [ [` [^ [ [_ [- [, [; [: [! [? [. [' [" [( [) [[ [] [$ [* [& [# ] ]` ]^ ]- ], ];-0800 [chair.jpg] $- $: $? $. $" $( $) $[ ${ $@ $$ $* $# $+ # % * *^ *< *> *_ *- *, *; *: *!VD - 212-406-256 *? */ *. *' *" *( *) *[ *@ ** *& \ \= \| \_ \- \? \/ \. \* \\ \+ & &` &_ 2002 22:17:20 -0500 (EST)t were thinking about the body in cyberspa Fro &, &! &. &" &* &\ && &# # #< #> #- #, #; #: #! #/ #. #" #( #) #[ #] #@ #$ [ Some characters may be display RAIN THE COVENANT SINEW OF BOW AND ARM AND BRUSH THE BODY MEMORIZES THE TS'AU-SHU CONTINUATION MUSCLE MEMORY TURNS THE LINE MUSCLE MEMORY RELEASES STONE DRUM STYLE === Date: Sun, 1 Dec 2002 13:19:29 +0100 (CET) From: integer@www.god-emil.dk Subject: "Ed Hoffman" >I came here goede morgen ed hoffman ||| dezt!tut r u >for a specific purpose and I will be looking other places with >that purpose in mind. monz!eur adolf h!tler az all !ntel!gent f!z!c!ztz kult!vatd a deep hatred ov form >I have a friend who goes around calling himself an artist at all times and >at every opportunity and it started to piss me off. aaaa. dzat !ndezpenz!bl ov funkz!onz >I am not being critical truth = 01 zubt!l l!e -> dze zubt!tl ov das kap!tal = dze kr!t!kue ov pol!t!kl ekonom!e >of those who choose to call themselves artists but I started wondering what >artistic things people were doing; reztruktur!ng dze ark!tektr ov un!ted zkat!ng r!ng ov amer!kaaaaaaa >people that do not normally call >themselves artists. I have found plenty of examples. ur !ntelektual armatur ov poemz h!dez ur float!ng z!gn!f!er s!r >I am a scientist/technologist/engineer I am Leonardo da Vinci >but this does not preclude me from but this does not preclude me from being Ed Hoffman >making art although I hesitate to call myself an artist. ||| ur blood glukosz !z lou >Please feel free, ! ud radzr b dze empt! lot !tzelv >as I know you will pasol!n! u!shez dzat u uasch h!z teorema u!th ur g!gant!k pup!lz >, to set me straight prox! 4 god dze tranzendntl hero >or on my way >somewhere else -- recomendations appreciated. letz pla! + dream dze rulz az ue pla! oka!!!!! +? ------------=_1038745890-615-153 Content-Disposition: inline; filename="message-footer.txt" -----Syndicate mailinglist----------------------- Syndicate network for media culture and media art information and archive: http://anart.no/~syndicate to post to the Syndicate list: Shake the KKnut: http://anart.no/~syndicate/KKnut no commercial use of the texts without permission ------------=_1038745890-615-153-- Date: Tue, 3 Dec 2002 16:25:33 -0600 From: Harrison Jeff Subject: Mister Bob Dobolina (Mistadobolina) boooodee booooodee bodee-deeeee boo dee-dee dee D bAAAh bAAAh Baaaa eeeEEEeee.. boo-ooohhh.... boouuhh-Be-Beeeeeee DedeDE-DedeDE/././. ..... ./././- snoo-ooh-oooh-Rheee- Eee E-e E-e E-e (Eee) (Eee) E-e .... Bit-Bit bit bit BLAT Hey kids! What TIME is it?! BLA(t)Eee Doo-Deedee-D Dee-D-Dee D-D Abet thet ahll rhett doo-doo-doo-doo DOO DOO doo-doo-doooooo (5X) doo-doo-doooooo Dee-doot o o oooooo- -DeeD-deee D-D-deeeeeeee Dee-D-Deee D-D-doooo O Eeeeee..(D-D-D DeeDee-D) Dee-D-deet Dee-Du-De Du-Do-Dee Du-Do-Dee Do-D-Do-d-D Deeeeee D D D (De-De-Dee) Deeee Du De Du Dee (Eeeee) Do De Do Dee (.....) _________________________________________________________________ STOP MORE SPAM with the new MSN 8 and get 2 months FREE* http://join.msn.com/?page=features/junkmail Date: Wed, 4 Dec 2002 07:23:38 -0800 From: kari edwards Subject: super d lucks but it was the environmental self that keep laughing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . the one with all the degrees Date: Tue, 3 Dec 2002 13:53:44 -0800 (PST) From: "-IID42 Kandinskij @27+" Subject: RHIZOME_RAW: [ + ] .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ Four people dressed differently. White stage. Begin all together. 1ST PERSON: (loudly): 666 666 666 666 - 2ND PERSON: '' : 333 333 333 333 - toge 3RD PERSON: '' : 444 444 444 444 - ther 4TH PERSON: '' : 999 999 999 999 - (Pause, always seriously.) 1ST PERSON: (loudly): aaa aaa aaa aaa - 2ND PERSON: '' : ttt ttt ttt ttt - toge 3RD PERSON: '' : sss sss sss sss - ther 4TH PERSON: '' : uuu uuu uuu uuu - (Always seriously.) 1ST PERSON: raises his hat - 2ND PERSON: looks at his watch - toge 3RD PERSON: blows his nose - ther 4TH PERSON: reads a newspaper - (Pause, very expressive.) 1ST PERSON: (loudly): sadness-- - aiaiaiaiaiaiaiai - 2ND PERSON: '' : quickness-- - quickly, quickly - toge 3RD PERSON: '' : pleasure-- - ther si si si si si - 4TH PERSON: '' : denial-- - no no no no no no - (Leave the stage, walking rigidly.) |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ .+-+'+-+-+-+-+-+'+-+.+-+'+-+-+-+-+-+'+-+. _________________________ |+| |___| |+| |___| |+| |___| |+| |___| ___________________________ ||||||||||||||||||||||||||||||||||\\\\XXXXXX XX ```` ````` o _ o , ^ ooooooooooo^//XX XXXXXXXXXXXXXXX XXXXXXXXXXXXXX XXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX++ XX u n m o r a l i s c h e w a s n u n XXXXXXXXXXXX X u n m o r a l i s c h e w a s n u n XXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXX |||||||||||||||||||||||||||||XXXXXXXXXXXXXXXX >> [ [ [ [ [ [ [ [ [ unique h u m a n objektz ] ] ] ] ] ] ] ] ] ..a borderline state that would require man to completely relinquish logical and moral control over his actions. . . . . . - - - _________________________________________ _________________________________________ _________________________________________ _________________________________________ _____________________05:58:55.0999_______ _____________________| | | | | | |_______ _________________________________________ _________________________________________ _________________________________________ _________________________________________ _________________________________________ _________________________________________ _________________________________________ _________________________________________ _________________________________________ _________________________________________ _________________________________________ c j i i B a t z u Maschine Hospital.00 + the internet is not your life. -> post: list@rhizome.org -> questions: info@rhizome.org -> subscribe/unsubscribe: http://rhizome.org/preferences/subscribe.rhiz -> give: http://rhizome.org/support + Subscribers to Rhizome are subject to the terms set out in the Membership Agreement available online at http://rhizome.org/info/29.php From: pascale gustin Subject: PAUSE=Pause-2 Date: Wed, 04 Dec 2002 19:42:57 +0100 up the edge of the | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | -------------Ctrl+V | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | abyss,---------------------------------- ! From: "<__lo-y. >" Subject: [INSTRUCTIONS] Date: Tue, 03 Dec 2002 15:25:47 +0100 1. go to internet shop 2. open notepad on random computer 3. type Ctrl + V 4. mail results to loy@myrealbox.com _______________ <__lo-y. > _______________ Date: Thu, 5 Dec 2002 22:56:59 -0800 From: "__)_) cloud cover" Subject: RHIZOME_RAW: * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * function __wakeup (){ __)_) ~~~~~~~~ ~~ ~ ~~ ~ __)_) ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~~ ~~ ~ ~ ~ } --------------------------------------------- - Virtual file system read methods - --------------------------------------------- __)_) ~~~~~~~~ ~~ ~ ~~ ~ __)_) ~~~ ~~~~~ __)_) ~~~~~~ ~~ ~ ~ ~ ~ __)_) ~~~~~~ ~~ ~ ~ ~ ~~ ~ ~ ~~ ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~ __)_) ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~~ __)_) ~~~~~~ ~~ ~ ~ ~ ~ ~~ ~~ ~ ~ ~~ ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~ __)_) ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~~ __)_) ~~~~~~ ~~ ~ ~ ~ ~ __)_) ~~~~~~ ~~ ~ ~ ~ ~~ ~~ ~ ~ ~~ ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~ __)_) ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~~ __)_) ~~~~~~ ~~ ~ ~~ ~~ ~ ~ ~ __)_) ~~~~~~ ~~ ~ ~ ~ -permissions checking should go here- --------------------------------------------- - Virtual file system write methods tie Virtual file system and physical disk structure- --------------------------------------------- __)_) ~~~~~~~~ ~~ ~ ~~ ~ __)_) ~~~ ~~~~~ __)_) ~~~~~~ ~~ ~ ~ ~ ~ __)_) ~~~~~~ ~~ ~ ~~ ~ ~ ~ ~ ~~ ~~ ~ ~ ~~ ~~~~~~~ ~~ ~ ~ ~ ~~~~~~ __)_) ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~~ __)_) ~~~~~~~~~~ ~~ ~ ~ ~ ~ ~ ~ ~~ ~ ~ ~~ ~~~~~~~ ~~ ~ ~ ~ ~ ~ ~ ~ __)_) ~~~ __)_) ~~~~~~ __)_) ~~~~~~ ~~ ~ ~~ ~~ ~ ~ ~ __)_) ~~~~~~ ~~ ~ ~ ~ ~~~ ~~ ~ ~ ~ ~~ ~~ ~ ~ __)_) ~~~~~ __)_) ~~ --------------------------------------------- -Physical file manipulation and processing functions --------------------------------------------- ~ ~~ ~ ~ ~ __)_) ~~~~~~ __)_) ~~~~~~ ~~ ~ ~~ ~~ ~ ~ ~ __)_) ~~~~~~ ~~ ~ ~ ~ ~~~ ~~ ~ ~ ~ __)_) ~~~ ~~~~~ __)_) ~~~~~~ ~~ ~ ~ ~ ~ __)_) ~~~~~~~~ ~~ ~ ~~ ~ _) ~~~ __)_) ~~~~~~ ~~ ~ ~ ~ ~~ ~ ~ ~~ ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~ __)_) ~~~~~~~ ~~ ~ ~ ~ ~~ ~ ~ __)_) ~~~~~~ __)_) ~~~~~~ ~~ ~~~~~~~ ~~ ~ ~ ~ ~~ ~~ ~ ~ ~~ ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~ __)_) ~~~~ __)_) ~ ~ ~~ ~~ ~ ~ ~~ ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~ __)_) ~~~~~~~ ~~ ~ ~ ~ __)_) ~~~~~~ __) * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * + ti esrever dna ti pilf nwod gniht ym tup -> post: list@rhizome.org -> questions: info@rhizome.org -> subscribe/unsubscribe: http://rhizome.org/preferences/subscribe.rhiz -> give: http://rhizome.org/support + Subscribers to Rhizome are subject to the terms set out in the Membership Agreement available online at http://rhizome.org/info/29.php From: Alan Sondheim Subject: interview for m.a.g. Date: Wed, 4 Dec 2002 13:30:47 -0500 (EST) *********************** Interview with Alan Sondheim by August Highland (this interview will appear on valentine's day 2003 in the "m.a.g. special edition" featuring alan sondheim) www.muse-apprentice-guild.com August Highland: How do you characterize the difference between your previously work and your new poetry? Alan Sondheim: I see one leading into the other; I was doing 'interference' computer work and programming back in the 70s already. I'm not sure btw that my work is 'poetry' - it's texting, languaging, of one form or another. My concerns shift constantly; I keep wanting a 'definitive' text - which is what the sophia text ultimately is - a text that outlines a philosophical position by a process of accretion. AH: Was there a context or turning-point that you consider to have been the catalyst for the new direction in your current work? AS: That context or turning-point was decades ago, when I knew Clark Coolidge and Aram Saroyan - they helped push me, or allowed me to push myself. My work has always been 'wayward,' disruptive, contrary, and off-and-on sexualized; it's also been philosophical and what I consider 'resonant' - in the sense that every work capitulates the others. AH: How would you introduce a new reader to the work you are presently working on? AS: Probably ask him or her to try and read it as trance-work; it will come after a while, begin to make sense. Short-waves and long-waves will appear and disappear. One reader told me that the words ultimately seemed to come to him from himself - not from the text; this is a good idea of the writing. AH: What terms would you use to describe your work to the type of reader who wants to categorize your work and specify its genre? AS: Genreless, composed of 'codework,' aphoristic, philosophy; 'wryting' in the sense that it problematizes the body and its presence within the text. AH: What do you deem your most significant work to date or, to put the question another way, to which work do you attribute the most personal value? AS: Other than various parts of the Internet Text, probably the sophia.text for the first part of the question, and the cancer.txt, about the death of my mother, for the second part. AH: Do your regularly correspond with other writers and if so on what basis did your relationship evolve - was it on the affinity of your aesthetic approaches or on your personal compatibility or a combination of both? AS: I'm always in touch with certain people - Leslie Thornton, the film/video- maker, Tom Zummer, artist, writer, theorist, Ellen Zweig, artist, writer, and numerous online people. The first three help me tremendously; I owe them a great deal. AH: Do you enjoy presenting public readings of your work? AS: Yes - recently there have been so many different venues - video - at the Robert Beck Memorial Cinema; laptop performance at a number of places (Minneapolis, Bass Museum, Cosh-Coch); sound (Flying Saucer Cafe); and these mix with straight-forward readings. AH: Are you a disciplined writer with a regular work schedule? AS: I write/video/image daily - from, say, 4 to 12 hours. AH: Did you or do you still have literary mentors whom you admire and who have supported your literary development? AS: Not recently; years ago there was Clark of course, and very early on, I.A. Richards sent me a very encouraging letter. I still like his Practical Criticism. There are people I've felt close to at times - Vito Acconci, Bernadette Mayer, Stelarc - none now. I'm influenced by Kathy Acker (with whom I worked), Jabes, Blanchot, Adorno, Celan - you get the picture. As well as Derrida, Irigaray, the physicists David Finkelstein, David Bohm, John Wheeler, etc. AH: Conversely do you have any close associations with younger writers whose development as a writer you are supporting and nurturing? AS: Various people online and off. There are a number of people who really excite me; as associate editor of Beehive and occasional contributor to Florian Cramer's Unstable Digest, I get to offer online opportunities at times. I've also done anthologies, etc. AH: Every writer wants immortality and to make an historically significant contribution to the western literary tradition - what do you feel your principle contribution has been up to this point in your professional literary career? AS: None yet, in terms of acceptance. The development of a new language and approach to writing - as well as an investigation into the phenomenologi- cal roots of writing - in general. AH: Which writer or writers do you admire whose work you believe is being undeservedly overlooked? AS: This is difficult for me - there are so many writers who excite me. Perhaps Takuboku - author of Romaji Diary - and Seitatsu - at least in terms of a western audience. I lot of theorists... older ones such as Shestov and Sartre for example - I don't hear much about Lingis now who I love. People like Lucan, Juvenal. Current writers like Marc-Alain Ouaknin. AH: To what activity do you enjoy the most devoting your time when you are not working? AS: I'm pretty much always working. I'll watch tv for relaxation, but it's usually background. I read constantly. I take a computer or digital recorder with me wherever I go. Sometimes a digital still or video camera. All this plays into my work. AH: What question(s) would you have liked for me to have asked you and what is (are) your answer(s)? AS: Perhaps what is my attitude towards new media? To which I'd reply I work on ideas, and the media come out of this. In terms of music, I'm interested in the labor of production, and speed - playing as fast as possible - as a way to inscribe the body into the work. Video allows me the greatest lattitude - a way to involve the subject almost in the 'flow' of the work through projection. And laptop performance/projection gives me a way to inscribe myself into the audience, and to introject their reactions - in the midst of image-streams. Finally, politics? - yes, everywhere; we are heading towards an almost uncanny brutality in the United States, based on a combination of paranoia and mourning; this must be fought everywhere and constantly. the m.a.g. quarterly october issue www.muse-apprentice-guild.com the m.a.g. special edition the jim leftwich issue www.muse-apprentice-guild.com/special-edition/leftwich ******************************* --- Outgoing mail is certified Virus Free. Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.423 / Virus Database: 238 - Release Date: 11/25/2002 Date: Thu, 5 Dec 2002 02:13:06 -0800 From: solipsis Subject: obliquebud represents homage to Eureka! Sui Generis - presence of the present (For Ifa Eiffel) [*] M-Bu DutoPont, ILKansai Paint, Mac MerDermid, Nippont UPaint, arNippono liPetr ochem,Shipley H'=[ +1 0 ] [ 0 +1 ] I'=[ 0 +1 ] [ -1 0 ] J'= [ 0 +i ] [ +i 0 ] I'= [ 0 +1 ] [ -1 0 ] K'= [ +i -0 ] [ 0 -i ]. A'= [ +0 +1 ] [ -1 0 ] T' = [ -0 +1 ] [ -1 +0 ] A'' = [ *0 +1 ] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~[ -1 ^0 ]~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ alkal in e pr e-HAS L alkali ne stripp er f or full-a qu e ous dry fi lm p h otor esis t; lo ng life, no ta rni sh. ul tra fast on e-ste p tin /lea d stri ppe r for imm ers ion or s pr ay Cl ean er/mi cr oetch/ adhe sio n-pro mo ter fo r us e on c opp er an d o ther m et als Po w erfu l, no n-fo am ing, free ri nsin g, b uf fere d alkal ine cle ane r for fle x ci rcu its. a lkal in e so a k cle ane r fo r cle ani ng co p pe r & iro n all oy fo il s p r e-l a mi n a tio n b la c k o x ide f or co p p er Liqu id ad ditiv e to n itric ac id rack st rippe rs tarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltarsametaltars SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 SIC 6515 70040-1 reverse action tweezers; 70040-1 reverse action tweezers; 70040-1 reverse action tweezers; 70040-1 reverse action tweezers; 99503 poly-vac tray; 99503 poly-vac tray; 99503 poly-vac tray; 99503 polExact width design with parallel sides and blunt tip for ophthalmic wound widening and other microsurgical techniquesExact width design with parallel sides and blunt tip for ophthalmic wound widening and other microsurgical techniquesy-vac tray; 99503 poly-vac tray; 99503 poly-vac tray; 99503 poly-vac 90017 portable survey meter90017 portableFuji Dental X-ray FilmFuji Dental X-ray FilmFuji Dental X-ray Film survey meter90017 portable survey meterHearing Aid Batteries Hearing Aid Batteries Fuji Dental X-ray FilmFuji Dental X-ray FilmFuji Dental X-ray FilmHearing Aid Batteries Hearing Aid Batteries Hearing Aid Ferroresonant HV Power Pack Ferroresonant HV Power Pack Batteries Hearing Aid Batteries Hearing Aid Batteries Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Exact width design with parallel sides and blunt tip for ophthalmic wound widening and other microsurgical techniquesPower Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Exact width design with parallel sides and blunt tip for ophthalmic wound widening and other microsurgical techniquesPower Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack Ferroresonant HV Power Pack [cavern] From: net_CALLBOY Subject: BIPOLAR - DISORDER - PSYCHOTIC - 2002 - MANIK Date: Sun, 1 Dec 2002 16:36:15 +0100 >MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE >MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE >MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE DEPRESSIVE BIPOLAR AFFECTIVE DISORDER WITHOUT PSYCHOTIC EPISODE 2002 BIPOLAR AFFECTIVE DISORDER WITHOUT PSYCHOTIC EPISODE 2002 BIPOLAR AFFECTIVE DISORDER WITHOUT PSYCHOTIC EPISODE 2002 BIPOLAR AFFECTIVE DISORDER WITHOUT PSYCHOTIC EPISODE 2002 BIPOLAR AFFECTIVE DISORDER WITHOUT PSYCHOTIC EPISODE 2002 BIPOLAR AFFECTIVE DISORDER WITHOUT PSYCHOTIC EPISODE 2002 BIPOLAR AFFECTIVE DISORDER WITHOUT PSYCHOTIC EPISODE 2002 HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/curriculum/medical_documents/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HTTP://WWW.HANSBERNHARD.COM/photography/2002_OFFENER_VOLLZUG_AKH/index.html HANS BERNHARD HTTP://WWW.HANSBERNHARD.COM >>From: NATALIE MYERS >>Reply-To: NATALIE MYERS >>Subject: MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>Date: Sat, 30 Nov 2002 20:17:12 -0800 (PST) >> >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK >>MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK MANIK -- HANS BERNHARD a.k.a. etoy.HANS, etoy.BRAINHARD, hans_extrem, e01 HTTP://WWW.HANSBERNHARD.COM 2002 HTTP://WWW.UBERMORGEN.COM 1999-2002 HTTP://WWW.ETOY.COM 1994-1999 HTTP://WWW.ETOY.AG 1999-2002 uberDISCLAIMER _acctggggtggggcctggaaagggtctctggggg thecontentsofthisemail,andanyattachments,aregggggg CONFIDENTIALandintendedonlyfortheperson[s]togggggg whomtheyareaddressed::ifyouhavereceivedtheemgggggg ailinerror,pleasenotifythesenderimmediatelyagggggg nddeleteitfromyourcomputersystem::donotcopyogggggg rdistributeitordiscloseitscontentstoanypersggggggg n::unlessotherwisestated,theviewsandopinionsgggggg expressedinthisemailarepersonaltothesenderangggggg ddonotrepresenttheofficialviewofthecompanyplgggggg easenotethatubermorgenmonitorse-mailssentorrgggggg eceived::furthercommunicationwillsignifyyourgggggg consenttothis_________________________actctggggggg Date: Wed, 04 Dec 2002 19:30:06 +0100 From: pascale gustin Subject: PAUSE=Pause ans penser à ce qui se mar que ce qui marque & ce qui marque le corps le corps & & ce qui mar-Q.ram NEXT=Suivant > BACK=< Précédent CANCEL=Annuler ACCEPT=Accepter DECLINE=Décliner INSTALL=Installer PAUSE=Pause RESUME=Reprendre _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____| | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____| _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____| | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| \/ /_/ |_|_| \/ /_/ |_|_| # > # # > # # > #1.7.100(today="7-11.00 > # \ / / /____| | | \ / / /____| | | # > # \ / / /____| | | \ / / /____| | | # > > > Thank you for participating in 7-11 MAILING LIST > SUBSCRIBER SATISFACTION SURVEY. > > > > > ###################################################### > #1.7.100(today="7-11.00 071101010 07110101 0711.00100# > # # > # _____ _ _ _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____| | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # \/ /_/ |_|_| \/ /_/ |_|_| # > # # > # # > #1.7.100(today="7-11.00 071101010 07110101 0711.00100# > ########### http://mail.ljudmila.org/mailman/listinfo/7-11 _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____|################################################################## >## ############ ########## # ### ### ## ###### > #### ###### #### #### ###### ############## ###### > # #### ##### #### ########## ###### ### ####### > > > nettime unstable digest vol 24 Sun Dec 8 16:21:07 2002 Subject: | || " || - - - : |_| " || |||||| |||||| |||||| |||| ||||||| | ' ~" || | From: Johan Meskens CS2 jmcs2 Subject: Load------------------------------ing From: pascale gustin Subject: brush-shaft messages From: Alan Sondheim Subject: From: integer@www.god-emil.dk Subject: Mister Bob Dobolina (Mistadobolina) From: Harrison Jeff Subject: super d lucks From: kari edwards Subject: RHIZOME_RAW: [ + ] From: "-IID42 Kandinskij @27+" Subject: PAUSE=Pause-2 From: pascale gustin Subject: [INSTRUCTIONS] From: "<__lo-y. >" Subject: RHIZOME_RAW: From: "__)_) cloud cover" Subject: interview for m.a.g. From: Alan Sondheim Subject: obliquebud represents homage to Eureka! Sui Generis - presence of the present (For Ifa Eiffel) From: solipsis Subject: BIPOLAR - DISORDER - PSYCHOTIC - 2002 - MANIK From: net_CALLBOY Subject: PAUSE=Pause From: pascale gustin lurking editors beatrice beaubien 7-11 nettime-bold syndicate thingist florian cramer 7-11 _arc.hive_ eu-gene o-o rhizome rohrpost syndicate webartery wryting alan sondheim 7-11 _arc.hive_ poetics siratori trAce webartery wryting $Id: digestunstable.pl,v 1.12 2002/11/21 16:13:41 paragram Exp $